Standard Name: AIM32; Systematic Name: YML050W; SGD ID: SGD: S000004514; Feature Type: ORF , Verified; Description: Protein of unknown function; null ...


KEGG T00005: YML050W





AIM32 - Altered inheritance of mitochondria protein 32 ...

YEAS7. 311. Altered inheritance of mitochondria protein 32 · YEAS8. 311. AIM32p protein · Saccharomyces sp. 'boulardii'. 311. YML050W-like protein · SACCK.


AIM32 protein (Saccharomyces cerevisiae) - STRING interaction ...

DNA repair and recombination protein RAD26; Protein involved in transcription- coupled nucleotide excision repair; repairs UV-induced DNA lesions; recruitment  ...


HIP HOP Results for strain with deletion in YML050W

HIP HOP results for strain with deletion in YML050W. The graph below shows the distribution of heterozygous (HIP) and homozygous (HOP) deletion strains as ...


SCMD Photo Viewer YML050w

Hypothetical ORF ( links to: CYGD SGD ). Photo Viewer. Cell · Nucleus · Actin. YML050w. [ prev10 ] [ prev ] 1 / 15 [ next ] [ next10 ]. [Individual Cell Datasheet] ...


AIM32 (YML050W) Result Summary | BioGRID

AIM32. YML050W. Putative protein of unknown function; null mutant is viable and displays elevated frequency of mitochondrial genome loss. GO Process (0).


HIPHOP chemogenomics database

YML050W / AIM32. Putative protein of unknown function; null mutant is viable and displays elevated frequency of mitochondrial genome loss. Zygosity: ...




YTRP »» TRP Results

Gln3, YER040W, AIM32, YML050W, 1, 4 ( Info ), 1, 0. Pho4, YFR034C, AIM32, YML050W, 1, 4 ( Info ), 1, 0. Sfp1, YLR403W, AIM32, YML050W, 1, 3 ( Info ), 2, 0  ...



Gene ID, YML050W. Original symbol, AIM32. Assigned symbol, AIM32. Original Description, Aim32p hypothetical protein; null mutant is viable anddisplays ...


Cluster: 4403 4404 4405 4406 4407 4408 4409 4410 4411 4412 ...

... YML050W) 4424 (92, YML049C) 4425 (93, YML048W) 4427 (95, YML047C) 4428 (96, YML046W) 4431 (99, YML043C) 4432 (100, YML042W) 4433 (101, ...




... aaagtgattacttgcagtttcgcgaaatctcgaagaattttttcaacttattgaaagaac atgaatatacttgttaacgtgattaaacgttttatcagaacaacctaagagtatctcctt ggtgaattagaagccagata ">YML050W ...




Details for GAL80

ScerTF. Details for GAL80. The Table below describes all of the matrices annotated to GAL80 in this database. For each individual matrix, we provide several ...


Saccharomyces cerevisiae S288c Altered Inheritance rate of ...

Accession IDs, G3O-32647 (YeastCyc) YML050W S000004514 Q04689 (UniProt ), Length, 936 bp / 311 aa. Map Position ...


Experiment details for FKH2

ScerTF. Experiment details for FKH2. The table below describes promoters bound in ChIP-chip experiments, and genes significantly affected by TF gene ...


Experiment details for NDD1

ScerTF. Experiment details for NDD1. The table below describes promoters bound in ChIP-chip experiments, and genes significantly affected by TF gene ...



... YJL051W YJL100W YJL148W YJL158C YJR091C YJR092W YJR127C YKR040C YKR044W YLR084C YLR131C YLR189C YLR190W YLR439W YML050W ...


Supplemental Material.docx

16 Apr 2013 ... YML050W, 0.0473, 35, 12, 23. YLR092W, 0.0235, 1549, 1581, 32. YKL219W, 0.0199, 59, 72, 13. YIL120W, 0.0270, 859, 836, 23. YIL064W ...



... YLR189C YLR286C YLR399C YLR439W YML050W YML053C YMR197C YNL170W YNL172W YNL173C YOL023W YPL116W YPL139C YPR149W ...


Supplemental file 1

11 Feb 2008 ... Mutants detected by the screening but not confirmed by MIC on microtitration plates. YGL071W. YGL148W. YML008C. YER086W. YHR025W.


YGL103W 0 YGL030W 0 YPL131W 0 YAL001C 0 YBL020W 0 ...

YML050W. 0.94. YLL040C. 0.95. YDR279W. 0.95. YGL037C. 0.95. YBR007C. 0.95. YML059C. 0.95. YDR108W. 0.95. YHR189W. 0.95. YPR097W. 0.95.


class I part 4

YML050W, XIII, 173139, 174074, biological_process unknown. YML051W, GAL80, XIII, 171594, 172901, negative regulator for expression of galactose- induced ...


C5 C23 C27 C51 C4 C8 C13 C37 C38 C47 C10 C16 C17 C18 C21 ...

YML050W. C39. YBR235W. YDL155W. YGR223C. YJR045C. YNL247W. YOR246C. C41. YEL053C. YER034W. YER146W. YGL048C. YHL004W. YIL046W.



125, YML050W, AIM32, SS. 126, YML060W, OGG1, SS*. 127, YML063W, RPS1B , SS. 128, YML097C, VPS9, SS. 129, YMR002W, MIC17, SL. 130, YMR004W ...


YAL022C YAL040C YAL053W YAL067C YAR003W YAR007C ...

... YLR466W YLR467W YML012W YML020W YML021C YML027W YML033W YML034W YML035C-A YML050W YML052W YML058W YML060W YML061C ...


plate42 - gTOW6000

30 Jun 2011 ... 4052, 42, F, 3, 22, 13, YML050W, 8103 (upYML050W), cggccgctctagaactagtggatccAATATCTCGCATTATAGTTTATA, 8104 ( downYML050W) ...


Gene IDs

548, YML034W, YML034W. 549, YML035C-A, YML035C-A. 550, YML050W, YML050W. 551, YML052W, SUR7. 552, YML058W, SML1. 553, YML060W, OGG1.


A Figure 6 B C

A. YIL167W. MRPS28. YML050W. RGT2. YHL026C. UTH1. SED1. YCR041W. YGP1. PRY1. YLR297W. MCM3. YOR066W. CDC46. GPA1. HST4. MCM6. TSM1 .


Saccharomyces cerevisiae



Table S9

23 Feb 2019 ... 89, YML050W, YIL155C. 90, YML100W-A, YIR018W. 91, YML132W, YIR034C. 92, YMR057C, YJL002C. 93, YMR106C, YJL066C.


See Venn diagram regulon

DNA binding targets: 4. Expression evidence targets: 744. DNA binding & Expression targets: 4. Potential targets: 3459. Potential & Expression targets: 384


YAL022C YAL040C YAL053W YAL067C YAR003W YAR007C ...

... YLR467W YML012W YML020W YML021C YML027W YML033W YML034W YML035C-A YML050W YML052W YML058W YML060W YML064C YML065W ...


Genetic Dissection of Transcriptional Regulation in Budding Yeast ...

YML050W YMR193W MRPL24 Mitochondrial ribosomal protein MRPL24 ( YmL24) YLR204W QRI5 YDR347W MRP1 37 kDa mitochondrial ribosomal protein


Organism Scer

Gene Name, Name, SwissProt, PID, Protein Name, Other Names. YLR317W . . 2258168 · AAB64530.1 · L_C144 · YLR320W . . . . L8543.13 · YLR320W .


composite dataset

... YBR092C YNL068C YER124C YNL068C YOR247W YNL068C YGL257C YNL068C YMR198W YNL068C YML050W YNL068C YDR261C YNL068C ...



Subscribe mumiracoutur.ga